Haplogroup G-M377

Haplogroup G2b-M377
Possible time of origin ~1,000 CE
Possible place of origin Northeastern West Asia
Ancestor G2 (P287)
Defining mutations M377, L72
Highest frequencies Pashtuns, Sepharadic Jews, Ashkenazi Jews, Mizrahi Jews, Palestinians, Lebanese, Syrians South West Syria,

Haplogroup G2b-M377 is a Y-chromosome haplogroup and is defined by the presence of the M377 mutation.[1] It is a branch of Haplogroup G2, which in turn is defined by the presence of the M201 mutation.[2]

G2b is a major Y chromosome haplogroup, and yet unique. It was found among Pashtuns and on much lower scale among all major Jewish groups, Palestinians, Lebanese and Syrians[3][4](See also page covering Jews with Haplogroup G (Y-DNA)) G2b presents more mysteries regarding its origin and distribution than virtually any other major Y haplogroup. Haplogroups that are rare in certain regions are more common in another, and have rather clear origins in other places where they are more commonly found. G2b has none of these obvious characteristics. Until the Second World War it was most common by far in Eastern Europe, a region where it arrived comparatively recently, but rare in other regions; including its likely area of origin. The distribution of G2b is sparse and dispersed, with almost no G2b haplotypes found in very large intervening regions. This pattern appears to be unique among Y haplogroups.

The extreme rarity of G2b in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire,then Alexander tried and failed in northern Pakistan and then formed a part of the Greco-Bactrian Kingdom). These two reported Pakistani G2b haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin. The Turkish G2b is somewhat closer, but not identical. It remains to be seen if testing will reveal G2b haplotypes in other populations — this is some indication that G2b occurs at low levels in the Near East. All G2b men tested so far have a rare null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH event, a finding not yet seen among most other G haplotypes. Among Jews in Israel drawn from many areas of the world, G2b constituted 3.7% in one study.[5] In 2012 Haplogroup G2b was found at a frequency of 60% out of a sample of 5 Pastuns in the Wardak region of Afghanistan. This is likely due to a local founder effect. .

Phylogenetic position

Extensive single nucleotide polymorphism (SNP) testing by the Haplogroup G SNP project[6] found that G2b is an independent branch of haplogroup G characterized by only one SNP, M377. A forthcoming study by the Y Chromosome Consortium at the University of Arizona found that within haplogroup G,G2b and G2 share an SNP, P287, which is not found in the other well-attested branch of G, haplogroup G1.

Recent changes to the phylogeny are listed in red.

     G      


G*



     G1 (M285,M342)     


G1*



      (P20)    

G1a



      (P76)    

G1b [new]




     G2 (P287) [new G2]     



G2* [new]



     G2a (P15, L31 = S149) [old G2]     


G2a* [old G2*]



     G2a1 (P16) [old G2a]     


G2a1* [old G2a]



         (P18)       

 G2a1a [old G2a1]




     (M286)     

G2a2 [old G2b]



     G2a3 (L30 = S126, L32 = S148 = U8) [new]     



G2a3* [new]



     G2a3a (M406) [new]     



G2a3a* [new]        





(L14 = S133) G2a3a1 [new]        





     G2a3b (P303) [new]     


G2a3b1 (U1 = S135)  [new]        

G2a3b* [new]        





     G2a3b1* [new]        





(L13 = S131 = U13) G2a3b1a [new]        






(S147, S148) G2a3b2a [new]        









     (M287)     

G2b [old G3]



     (M377)     

G2c* [old G5]


     (M283) [new]     

G2c1 [new]






Haplogroup G SNP reference table
Ref SNP ID Ethnoancestry Family Tree DNA G SNP Project
rs35160044 G2
rs34134567 S126 L30 U8
rs35474563 S130 L14 U16?
rs9786706 S131 L13 U13
rs9786246 S132
rs35169834 S133
rs34977142 S134 U16?
rs9786316? S135 U1?
rs34334142 S146
rs35251548 S147
rs7892988 S148 L32
rs35617575 S149 L31

Haplogroup characteristics

Distinguishing Y-STR alleles

For the full listing of all the G2b Y-STR modal haplotype values, see the entry:
HRGEN in ySearch.org

All G2b samples tested so far have a null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic Y-STR, the result of a RecLOH event. This change is extremely uncommon in the rest of haplogroup G, but apparently happened early in the history of G2b.

G2b Y-STR distinguishing allele values
Y-STR Allele range Modals
DYS393 12-13 13
DYS390 23-24 23
DYS19 15-17 15
17
DYS391 10-12 10
11
DYS385* 13,15
13,16
13,17
14,16
13,16
DYS426 11
DYS388 12
DYS439 11-12 11
DYS392 11
DYS389 13,29
13,30
13,31
14,31
14,32
14,33
15,33
13,30
14,31
14,32
DYS459 8,9
DYS464 13,13,14,15
13,13,15,15
13,14,14,15
13,14,15,15
13,14,15,15
DYS607 15-1716
DYS395S1a 16,16
DYS425 null
DYS413 21,22
DYS436 11
DYS481 19
DYS461 12

* In haplogroup G2b, according to the Kittler Protocol for DYS385 which tests for the actual order of the DYS385 alleles along the Y chromosome, the smaller allele precedes the larger and therefore the allele sequence given here is physically correct.

Primer sequence

SNP
name
gene gene
location
Y position
M377 DDX3Y intron 10 15,536,827
Primer (5'→3')[1]
position
(bp)
SNP forward reverse length
(bp)
40 A→T tatgcatttgttgagtatatgtc gttctgaatgaaagttcaaacg 326

Distribution

Ashkenazi Jews

A cluster of closely related Ashkenazi Jews represent virtually all confirmed G2b persons worldwide, both from private testing, and from academic studies. Of 211 known European G2bs, 8 are known to have non-Jewish patrilineal ancestors. G2b makes up about 7% of all Ashkenazi Jewish Y chromosome haplotypes, as was found in Behar et al. (2004) (n=442, GxG2=33).[7] In the supplemental data from Behar et al. (2004), among the Ashkenazi Jewish G haplotypes haplotypes 4 and 6-15 are G2b, 2,3,5 are G1, and the haplogroup of the first listed is unclear. A much smaller group of Ashkenazi Jews however are in haplogroup G1, so not all GxG2 Ashkenazi Jews in the above study would be G2b. In a sample of 955 haplogroup G haplotypes, there are 103 Ashkenazi G2bs and 14 Ashkenazi G1s. The ratio of G2b:G1 among Ashkenazi Jews is approximately 10:1.

Eastern Europe

The distribution of G2b in Eastern Europe very closely reflects the 16th and 17th century settlement patterns of Ashkenazi Jews in the Polish-Lithuanian Commonwealth:

Map of the partition of the Kingdom of Poland and the Grand Duchy of Lithuania from 1799. The full extent of the Polish-Lithuanian Commonwealth before partition in 1765 closely matches the distribution of G2b in Eastern Europe. The areas in this map colored yellow were taken by Prussia, those colored green were taken by Austria, and those colored pink by Russia.

Western Germany

G2b is also found among Ashkenazi Jews from Western Germany. Jews were not allowed to reside in most parts of Germany in the 16th and 17th centuries, aside from the Frankfurt Jewish Ghetto. Jews were expelled in 1670 from Vienna and the Archduchy of Austria.[8] After Khmelnytsky's Pogrom in Poland in 1648, there began a migration of Jews from Poland and Lithuania to Western Germany, which accelerated and continued into the 19th century. A significant number of German Jewish G2bs appear to represent a pre-1640s independent settlement; some however may be the result of a migration from Eastern Europe.

Sicily

Among Europeans, there are a few significant exceptions to this almost exclusive Ashkenazi Jewish distribution - out of the more than 2,000 known European G2bs, there are 4 Sicilians, including 3 members of one family with a tradition of Jewish patrilineal descent from the 16th century Sicily.

Southwest Syria

It appears as if there are a few individuals of Syrian descent that also share this haplogroup. However, their split from the rest of the group should be a minimum of 2,000 years with further testing. It appears as if this group will fall into the G2b2 group and not the G2b1 group with the Pashtuns. The highlands of the Syria could very well be the origin of haplogroup G as a whole due to the diverse G haplogroups seeming to originate there in ancient times.

Eastern Anatolia

A confirmed G2b Y-STR haplotype[9] found in the literature is haplotype 54 from a study of Anatolian Y chromosomes (n=523) by Cinnioglu et al. (2004) which was found in Eastern Turkey, in the city of Kars, very close to Armenia.[10]

The Hindu Kush and Kashmir (Pakistan)

Map of the distribution of the major ethnic groups in Pakistan and Afghanistan, with the Pashtun areas shaded in green.

There are just two other confirmed G2b samples that have been publicly reported in the academic literature so far, one Pashtun in the Khyber Pakhtunkhwa province of Pakistan (the Hindu Kush Range), and one Burusho in the Hunza Valley in Kashmir. These two G2bs are Y-STR haplotypes 731 and 794 from Table 3 in the study by Sengupta et al. (2006) of Indian (n=728), Pakistani (n=176), and East Asian (n=175) Y chromosome lineages.[1] Firasat et al. (2007) found 1 G among 97 Burushos, and in Sengupta et al. (2006) the only Burusho G was G2b, making it likely that this single G is G2b as well.[11] The Y Chromosome Haplotype Reference Database has several haplotypes from India and Pakistan that are very likely to be G2b .

Afghanistan

Haplogroup G2b has been found at a frequency of 60% out of a sample of 5 Pastuns in the Wardak region of Afghanistan. This is likely due to a local founder effect .

Hunza

Map showing the Karakorum Highway, which passes through the main towns of Hunza, Baltit and the capital of Hunza Karimabad (formerly Baltit), and follows the route of the southern Silk Road.

Hunza was an important stop on the Silk Road from the Near East to China. The fertile Hunza Valley was the last resting point before the Khunjerab Pass (el. 4693 m./15397 ft.) which was the highest point on the southern route of the Silk Road from Iran, the Indian Ocean ports of the Makran Coast in Pakistan, to the Kashgar oasis in the Gobi Desert of western China. Among the Burusho South Asian Y haplogroups predominate, but there are some representatives of Central Asian (C-M217) and East Asian (O3) haplogroups as well.[1][11] Sengupta et al. (2006) found the Burushos to be completely lacking in haplogroup G2a, which is well represented among the nearby Kalash and Pashtun populations.[11]

Historical background of the Ani region

In 894 CE, the Bagratid Prince Ashot I was given the title of King of Armenia by the Abbasid Caliphate[12] and briefly established his capital at the ancient Armenian center of Bagaran 40 km south of Ani, and then moved it to Shirakavan, 15 km northeast of Ani. In 929 the capital was transferred to Kars, 42 km west of Ani, and then in 969 to Ani itself.[13][14] Ani in the 10th and 11th centuries had a population as high as 100,000 - 200,000. The city continued to flourish even after the capture of Ani in 1064 by the Seljuks under Alp Arslan, and the subsequent rule by the Kurdish Muslim Shaddadid dynasty from 1072-1199. In 1199 Ani was captured by the forces of Queen Tamar of Georgia and a Georgian vassal kingdom was created which was ruled by the Zakarid dynasty. In 1236, the Mongols captured Ani, killing many of its inhabitants, but afterward it was continued to be ruled by the Georgian Zakarids. After its capture by the Turkic Kara Koyunlu in the 1330s, Ani declined rapidly. The Kara Koyunlu moved their capital to Yerevan in 1446 and by the 18th century Ani had been completely abandoned.[15]

There is no evidence that Ani or the adjacent areas ever had a Jewish population in the Medieval period.[16] There may have been an early presence of Jews in the Kingdom of Armenia in late Hellenistic and Roman times before the conversion of Armenia to Christianity,[17] However, the possible presence of G2b almost exclusively in the region of the Medieval capitals of Armenia, Bagaran, Shirakavan, Kars, and Ani would indicate that, if indeed these haplotypes are G2b, it appeared in Armenia no earlier than 802 CE and no later than the mid-14th century.

Other predicted G2b Jewish haplotypes

Two possible G2b Y-STR haplotype samples in the literature are from the study of Jewish and non-Jewish Near Eastern Y chromosomes by Nebel et al. (2001) (in the Appendix Table A1), haplotype 51 which was found in 1 Ashkenazi Jew (n=79) and 3 Kurdish Jews[18] (n=99), and haplotype 47 which was found in 1 Iraqi Jew (combined Iraqi Jews n=20 and Syrian Jews n=3). However, recently advancements in haplogroup prediction have determined these haplotypes G2b. These also belong to what was termed at the time "Haplogroup 2", (F*,G, and I)[19] and within this set of haplogroups these display a Y-STR allele pattern unique to haplogroup G2b. In this study, G2b was found among 3% of Kurdish Jews.[20] However, as with the Armenians, there are some G2 haplotypes that appear similar to G2b at these 6 STRs, but not at DYS389.[21]

Upcoming studies

Other Y chromosome samples taken from an upcoming study of Sephardi and Near Eastern (Mizrahi) Jews have found only a few GxG2 (in Y chromosome haplogroup G but not in G2) samples. Preliminary indications are that in this study, only a single Turkish Jew matches any of the modal haplotypes for G2b, however, all of these samples are being tested for M377/G2b.

The Kurdish and Iraqi Jewish samples from Nebel et al. (2002) are also being tested for M377/G2b by a different group for another study. Y chromosome haplogroup G1 is also found among Jewish populations, but it is likely that some of these samples will turn out to be in haplogroup G2b.

Comparison of regional haplotypes

Population and
Location
n Status DYS393 DYS390 DYS19 DYS391 DYS385 DYS426 DYS388 DYS439 DYS392 DYS389 DYS438 DYS461
= add 2 to DYSA7.2
Ashkenazi Jews

Poland–Lithuania
Western Germany Sicilians

300 confirmed 12
13
 
22
23
24
 
15
16
9
10
11
13,15
13,16
14,16
11 12  
11
12
11 13,30
13,31
13,32
13,33
14,31
14,32
14,33
15,33
10 12
Turkey
Kars
1 confirmed 13 23 16 10 11 12 11 11 13,29
Pathans 1 confirmed 13 23 16 11 13,16 11 12 11 11 13,30
Pathans 6 confirmed 13 23 17 10 11 12 11 11 13,30 12
Burusho
Hunza Valley
1 confirmed 13 23 17 11 11 12 11 11 13,30 12
Greek
Athens
1 unlikely 13 23 16 11 13,16 11 13,31
Syrians 2 unlikely 13 23 16 11 14,16
14,15
11 13,30
Iranian
Tehran
1 unlikely 13 23 17 10 13,16 11 13,29
Iraqi Jew 1 predicted G2b 13 23 15 11 11 12 11
Armenians
The Ani region
Nagorno-Karabakh
5 predicted G2b 13 23 15 10 11 12 11
Kurdish Jews 3 predicted G2b 13 23 15 10 11 12 11

Time to the Most Recent Common Ancestor (tMRCA)

The time to the Most Recent Common Ancestor (tMRCA) for European G2b, derived by generating a median-joining network[22] of over 25 haplotypes with 67 Y-STRs, yields a date of 955 years from the average birth year of the testees (estimated to be 1950), with a standard deviation of 107 years.[23] The mutation rate used is based on that of family groups with known most recent common ancestors.[24] So far, this tMRCA includes all groups of European G2bs, including it seems from preliminary evidence, the Italians.

This late tMRCA date for all of G2b in Europe raises the question of when G2b first entered Europe. If G2b entered Europe at an earlier period, we would expect to see more divergent haplotypes than we currently see. The very unusual highly ethnically-specific distribution of G2b in Europe combined with the very late tMRCA raises the question of from where G2b could have entered Europe. Also, was the spread of G2b in Europe from the Kingdom of Poland to Germany and Italy, from German to Italy and Poland, or Italy northward to both other areas? No one particular region seems to be more divergent than any other, and in fact, there doesn't seem to be any geographically correlated subclades within European G2b, with samples from each region matching some from other regions more closely than ones from the same region.

Possible history

Sicily

The a scenario for the spread of G2b within Europe is an origin among Jews in Sicily, and a spread northward to Germany and the Polish-Lithuanian Commonwealth at the time of the expulsion of the Jews of Sicily in 1492.

It is estimated that Jews made up 6% or more of the population of Sicily in 1492.[25] Historical evidence shows that most Sicilian Jews went eastward to the Ottoman Empire, where Sicilian Jewish congregations existed in Salonika and Constantinople until the late 19th century. However, it is known that many Sicilian Jews first went to Calabria, and then Jews were expelled from Calabria in 1524, and later from the entire Kingdom of Naples in 1540. There was a gradual movement throughout the 16th century of Jews in Italy from south to north, with conditions worsening for Jews in Rome after 1556 and Venice in the 1580s. Many Jews from Venice and the surrounding area migrated to Poland and Lithuania at this time.[25][26][27][28]

In this scenario it may be that there was a direct migration from Sicily or Southern Italy separately to both Western Germany and Poland-Lithuania, but the presence of G2b in Germany may be due to an earlier migration from France or Spain; as the presence of G2b2 ancestors in Germany appears to date from at least the early 1500s.

Jews had lived in Sicily since Roman times. After the Byzantine reconquest of Sicily from the Arian Ostrogoths who were very tolerant of the Jews in 552, conditions worsened dramatically for Jews in Sicily. Under the Byzantine Empire few Jews lived in Sicily because of official persecution. Before 606 the bishop of Palermo ordered the synagogue to be converted into a church. An edict issued by Leo III the Isaurian in 722 which ordered the baptism by force of all Jews in the Empire.[29] After the Muslim conquest of Sicily in 831-902, large numbers of Jews settled on the island.[30] In 972, the Arab merchant Ibn Hawqal mentioned a Jewish Quarter in Palermo, and by 1170, Benjamin of Tudela reported 1500 Jewish households in Palermo and 200 in Messina.[31] In 1149, Roger II forcibly brought the Jewish brocade, damask, and silk weavers of Thebes in Greece to Sicily to establish a silk industry there.[25][32][33] This is an example of a late entry into Sicily of non-Iberian, non-Provençal Jews from outside of Western and Central Europe, from a region that has been poorly tested or devoid of Jews in modern times.

The preliminary conclusions from this evidence is that haplogroup G2b is not native to Europe. The very late tMRCA, and the very high ethnic specificity indicate a rather brief presence in Europe, but one that participated in the exponential growth of the Ashkenazi Jewish population in Eastern and Central Europe after the Black Death. The complete lack of G2b in Iberia and also so far among Spanish Jews indicates that G2b didn't come from Spain, or France, since some Spanish Jewish families originated in southern France and migrated to Spain after France expelled the Jews in 1306. This, along with the other evidence, leaves Sicily as the European origin of G2b. We know that Greek and Mizrahi Jews arrived in Sicily as late as 1149, and that primarily most Sicilian Jews settled there during the Arab Emirate of Sicily. This is one way of explaining the very late presence of G2b in Europe, the likely presence of G2b among at least Kurdish Jews, if not other Mizrahi Jews as well.

The East - the Pathans and the Burushos

The presence of G2b in these areas may be accounted for by several separate theories, each with their own time scale. It does seem very likely that G2b originated in the Near East, in Anatolia or Syria, and spread both eastward and westward from there.

One often stated idea is of a direct Israelite ancestry for the Pashtuns as a whole. These stories were disseminated in Medieval times for religious reasons, and as part of the competition between the Mughals and the Pashtuns. However, this does not negate a possible Medieval Jewish origin for some of the Pashtun sub-tribes, but this would depend on the frequency of G2b among the Pashtuns, since any Jewish genetic admixture in relatively recent times would have been limited in scope.

The Silk Road

The Medieval Silk Road, which extended from Sicily to Samarkand, the Hunza Valley, and on to Kaifeng, China.

The rarity of G2b in northeast Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period from further west (this area was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). These two reported G2b haplotypes seem to be quite divergent from both the Ashkenazi Jewish clade and the lone northeastern Anatolian G2b based on only 10 Y-STRs, and therefore may not indicate a recent common origin. Another possible route which brought G2b to this region is through trade, because Hunza is a fertile valley that was a major stopping point along the southern Silk Road just before the Khunjerab Pass into China.[34]

A Northern Near Eastern / South Caucasian origin for G2b is much more likely. The Turkish G2b haplotype, and 5 of 6 other almost certain G2b Armenian haplotypes have ancestors from a small region in Kars Province of Turkey near the Medieval capitals of Armenia. The rarity of G2b, which is limited to this small area which only became important after the year 884 is most likely due to G2b arriving in the region after this time.

Again, the Jewish areas of Kurdistan were not far from this same region. Haplogroup G has its greatest diversity in this same area, where all recorded sub-haplogroups of G have been found, so the evidence seems to point to this region of Eastern Anatolia or south of the Caucasus as the area of origin for all of haplogroup G as well. G2b could have spread from this region eastward toward the Hindu Kush and the Karakorum ranges, and southward among the Judeans, and then subsequently westward with the Jewish Diaspora to Italy and then Central and Eastern Europe.

Famous people in haplogroup G2b

Physicist and author.
Leading American film and television actor.
Former Chairman of the United States Federal Communications Commission (FCC) and Chairman of the Public Broadcasting Service (PBS).

See also

References

  1. 1 2 3 4 Sengupta S, Zhivotovsky LA, King R, Mehdi SQ, Edmonds CA, Chow CE, Lin AA, Mitra M, Sil SK, Ramesh A, Usha Rani MV, Thakur CM, Cavalli-Sforza LL, Majumder PP, Underhill PA (Feb 2006). "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists". American Journal of Human Genetics. 78 (2): 202–21. doi:10.1086/499411. PMC 1380230Freely accessible. PMID 16400607.
  2. ↑ snpdev. "Reference SNP (refSNP) Cluster Report: rs2032636". nih.gov.
  3. ↑ "The Genetic Atlas". thegeneticatlas.com.
  4. ↑ Behar DM, et al. "The genome-wide structure of the Jewish people.". nih.gov.
  5. ↑ Hammer MF, Behar DM, Karafet TM, Mendez FL, Hallmark B, Erez T, Zhivotovsky LA, Rosset S, Skorecki K (Nov 2009). "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood". Human Genetics. 126 (5): 707–17. doi:10.1007/s00439-009-0727-5. PMC 2771134Freely accessible. PMID 19669163.
  6. ↑ Dennis Garvey (2006-11-17), h Haplogroup G SNP project, archived from the original on 2007-09-28
  7. ↑ Behar DM, Garrigan D, Kaplan ME, Mobasher Z, Rosengarten D, Karafet TM, Quintana-Murci L, Ostrer H, Skorecki K, Hammer MF (Mar 2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations". Human Genetics. 114 (4): 354–65. doi:10.1007/s00439-003-1073-7. PMID 14740294.
  8. ↑ Deutsch, Gotthard (1906). "Austria - From the Expulsion of 1420 to that of 1670". Jewish Encyclopedia. Retrieved 2007-09-16.
  9. ↑ Underhill, Peter (2007-09-24). "Personal communication from the primary author".
  10. ↑ Cinnioğlu C, King R, Kivisild T, Kalfoğlu E, Atasoy S, Cavalleri GL, Lillie AS, Roseman CC, Lin AA, Prince K, Oefner PJ, Shen P, Semino O, Cavalli-Sforza LL, Underhill PA (Jan 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639.
  11. 1 2 3 Firasat S, Khaliq S, Mohyuddin A, Papaioannou M, Tyler-Smith C, Underhill PA, Ayub Q (Jan 2007). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics. 15 (1): 121–6. doi:10.1038/sj.ejhg.5201726. PMC 2588664Freely accessible. PMID 17047675.
  12. ↑ Hovannisian, Richard G. (1997). The Armenian people from ancient to modern times: from antiquity to the fourteenth century. Palgrave Macmillan. p. 136. ISBN 0-312-10168-6.
  13. ↑ Kurkjian, Vahan (1958). History of Armenia. Armenian General Benevolent Union of America. pp. Chapter XXIV The Bagratid Dynasty – The Bagratuni pg. 186 ff.
  14. ↑ Hewsen, Robert H. (2001). Armenia: A Historical Atlas. Chicago, Illinois: The University of Chicago Press. pp. Map 91. The Bagratid Kingdoms in Armenia, 962–1064. ISBN 978-0-226-33228-4.
  15. ↑ "VitrualANI - The City of Ani: A very brief history". Retrieved 2007-10-02.
  16. ↑ of Rubruck, William (c. 1255). Itinerarium fratris Willielmi de Rubruquis de ordine fratrum Minorum, Galli, Anno gratia 1253 ad partes Orientales. pp. Chapter XXXVIII.
  17. ↑ Alexanian, Moorad (2000-06-16). "ASA - June 2000: Jewish History of Armenia". Retrieved 2007-10-02.
  18. ↑ Rosenthal, Herman; J.G. Lipman (1906-05-01). "Kurdistan". In Isidore Singer, Ph.D. Jewish Encyclopedia (1st ed.). New York, New York: Funk & Wagnall. pp. 585–586. Retrieved 2007-10-20.
  19. ↑ Y Chromosome Consortium (2002). "YCC NRY Tree 2002 v2002.01.18". Retrieved 2007-09-16.
  20. ↑ Nebel A, Filon D, Brinkmann B, Majumder PP, Faerman M, Oppenheim A (Nov 2001). "The Y chromosome pool of Jews as part of the genetic landscape of the Middle East". American Journal of Human Genetics. 69 (5): 1095–112. doi:10.1086/324070. PMC 1274378Freely accessible. PMID 11573163.
  21. ↑ "ySearch haplotypes in G2 and I which match G2b at 6 STRs". Retrieved 2007-10-08.
  22. ↑ Bandelt HJ, Forster P, Röhl A (Jan 1999). "Median-joining networks for inferring intraspecific phylogenies". Molecular Biology and Evolution. 16 (1): 37–48. doi:10.1093/oxfordjournals.molbev.a026036. PMID 10331250.
  23. ↑ Kandell, Ted. "G2b tMRCA estimate (fast mutation STRs = 5) @ 81 years per rho = 1489". Retrieved 2007-10-03.
  24. ↑ Kandell, Ted (2007-09-29). "G2b Athey family median-joining network tMRCA estimate (fast mutating STRs = 5) @ 81 years per rho = 1641 (average birth year = 1947, known MRCA b. 1643)". Retrieved 2007-10-03.
  25. 1 2 3 Talalay Dardashti, Schelly (2006-08-20). "Tracing the Tribe: At the ICJG: Jews in Italy". Retrieved 2007-09-19.
  26. ↑ Singer, Isidore (1906). "Rapoport". Jewish Encyclopedia. Retrieved 2007-09-16.
  27. ↑ Kayserling, Meyer; Gotthard Deutsch; M. Seligsohn; Peter Wiernik; N.T. London; Solomon Schechter; Henry Malter; Herman Rosenthal; Joseph Jacobs (1906). "Katzenellenbogen". Jewish Encyclopedia. Retrieved 2007-09-16.
  28. ↑ Colletta, John Phillip (2003). Finding Italian Roots: The Complete Guide for Americans. Genealogical Publishing. pp. 146–148. ISBN 0-8063-1741-8.
  29. ↑ Neil, Bronwen (2000-11-25). "Roman Emperors - DIR Leo II". Retrieved 2007-09-23.
  30. ↑ Cracco Ruggini, Lellia (1984). "Christianization in Sicily (IIIrd - VIIth Century)" (PDF). Gerión: 226. Retrieved 2007-09-23.
  31. ↑ Dieli, Art (2005-12-13). "Italia Judaica". Retrieved 2007-09-23.
  32. ↑ Martino, Giuseppe (2005-10-11). "The Jews of Messina" (in Italian and English). Retrieved 2007-09-19.
  33. ↑ Dieli, Art (2005-11-29). "Jewish Names in Sicily". Retrieved 2007-09-19.
  34. ↑ Shirazi, S.A.J. (2006-07-11). "Guest Post: Adventures up the Silk Road: All Things Pakistan". Retrieved 2007-09-23.

Sites

Maps

Mailing Lists

Phylogenetic tree of human Y-chromosome DNA haplogroups [χ 1][χ 2]
"Y-chromosomal Adam"
A00 A0-T [χ 3]
A0 A1 [χ 4]
A1a A1b
A1b1 BT
B CT
DE CF
D E C F
F1  F2  F3  GHIJK
G HIJK
IJK H
IJ   K
I J    LT [χ 5]  K2
L T [χ 6] NO [χ 7] K2b [χ 8]     K2c  K2d  K2e [χ 9]
N   O   K2b1 [χ 10]     P
K2b1a[χ 11]     K2b1b K2b1c      M     P1 P2
K2b1a1   K2b1a2   K2b1a3 S [χ 12] Q   R
  1. ↑ Van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation. 35 (2): 187–91. doi:10.1002/humu.22468. PMID 24166809.
  2. ↑ International Society of Genetic Genealogy (ISOGG; 2015), Y-DNA Haplogroup Tree 2015. (Access date: 1 February 2015.)
  3. ↑ Haplogroup A0-T is also known as A0'1'2'3'4.
  4. ↑ Haplogroup A1 is also known as A1'2'3'4.
  5. ↑ Haplogroup LT (L298/P326) is also known as Haplogroup K1.
  6. ↑ Between 2002 and 2008, Haplogroup T (M184) was known as "Haplogroup K2" – that name has since been re-assigned to K-M526, the sibling of Haplogroup LT.
  7. ↑ Haplogroup NO (M214) is also known as Haplogroup K2a (although the present Haplogroup K2e was also previously known as "K2a").
  8. ↑ Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.
  9. ↑ Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a, also known as Haplogroup NO).
  10. ↑ Haplogroup K2b1 (P397/P399) is similar to the former Haplogroup MS, but has a broader and more complex internal structure.
  11. ↑ Haplogroup K2b1a has also been known as Haplogroup S-P405.
  12. ↑ Haplogroup S (S-M230), also known as K2b1a4, was previously known as Haplogroup K5.
This article is issued from Wikipedia - version of the 11/12/2016. The text is available under the Creative Commons Attribution/Share Alike but additional terms may apply for the media files.