Haplogroup Q-M242

Haplogroup Q
Possible time of origin 17,200 to 31,700 years ago [1][2][3] (approximately 24,500 years BP)
Possible place of origin Central Asia,[4][5] South Central Siberia)[2]
Ancestor P1-M45
Descendants L274 / P36.2
Defining mutations M242
Highest frequencies Kets, Selkups, Inuit, the indigenous peoples of the Americas, Akha people of northern Thailand, and Turkmens

Haplogroup Q-M242 is a Y-chromosome DNA haplogroup.

Origins

Haplogroup Q-M242 is one of the two branches of P1-M45. (The other is R-M207.)

Q-M242 is believed to have arisen around the Altai Mountains area (or South Central Siberia),[2] approximately 17,000[2] to 31,700 years ago.[3] However, the matter remains unclear due to limited sample sizes and changing definitions of Haplogroup Q: early definitions used a combination of the SNPs M242, P36.2, and MEH2 as defining mutations.

This haplogroup has over a dozen subclades that have been sampled and identified in modern populations. Also, there are very diverse sub-haplotypes.

Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc

Subclades

In Y chromosome phylogenetics, subclades are the branches of a haplogroup. These subclades are also defined by single-nucleotide polymorphisms (SNPs) or unique-event polymorphisms (UEPs). Haplogroup Q-M242, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.

Phylogenetic trees

There are several confirmed and proposed phylogenetic trees available for haplogroup Q-M242. The scientifically accepted one is the Y Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.

The Genomic Research Center draft tree

This is Thomas Krahn at the Genomic Research Center's Draft tree[6] for haplogroup Q-M242. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.[7]

The Y Chromosome Consortium tree

This is the official scientific tree produced by the Y Chromosome Consortium (YCC). The last major update was in 2008.[8] Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update.[9] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

The 2015 ISOGG tree

The subclades of Haplogroup Q-M242 with their defining mutation (s), according to the 2015 ISOGG tree[4] are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

Phylogenetic variants

The subclade (under Q-MEH2) proposed by Sharma 2007, which shows polymorphism (ss4bp, rs41352448) at 72,314 position of human arylsulfatase D pseudogene, is not represented in any current trees under Q-MEH2.[10] The most plausible explanation for this could be an ancestral migration of individuals bearing Q-MEH2 to the Indian subcontinent followed by an autochthonous differentiation to Q-ss4bp.[5]

Distribution

Haplogroup Q-M242 is one of the most widely distributed Y-chromosome lineages in the modern world. It is found in the Americas, Asia, Europe, and North Africa.

Americas

Several branches of haplogroup Q-M242 have been predominant pre-Columbian male lineages in indigenous peoples of the Americas. Most of them are descendants of the major founding groups who migrated from Asia into the Americas by crossing the Bering Strait.[2] These small groups of founders must have included men from the Q-M346, Q-L54, Q-Z780, and Q-M3 lineages. In the North America, two other Q-lineages also have been found. These are Q-P89.1 (under Q-MEH2) and Q-NWT01. They may have not been from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of Far East Asia and then the Americas using boats.

It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of the shifts in a small founder population over time. Anyway, Q-M242 came to dominate the paternal lineages in the Americas.

North America

In the indigenous people of North America, Q-M242 is found in Na-Dené speakers at an average rate of 68%. The highest frequency is 92.3% in Navajo, followed by 78.1% in Apache,[2] 87%[2] in SC Apache,[11] and about 80% in North American Eskimo (Inuit)–Aleut populations. (Q-M3 occupies 46% among Q in North America)[12]

On the other hand, a 4000-year-old Saqqaq individual belonging to Q1a-MEH2* has been found in Greenland. Surprisingly, he was turned out to be generically more closely related to Far East Siberians such as Koryaks and Chukchi people rather than Native Americans.[13] Today, the frequency of Q runs at 53.7% (122/227: 70 Q-NWT01, 52 Q-M3) in Greenland, showing the highest in east Sermersooq at 82% and the lowest in Qeqqata at 30%.[14]

Q-M242 is estimated to occupy 3.1% of the whole US population in 2010: According to the US National Population Census data (2010),[15] the frequency of White people (xHispaic) is 63.7%, followed by Hispanic 16.3%, Black 12.6%, Asian 4.8%, Native American (mainland and Alaska, not including the Pacific islands) 0.9%, etc. And haplogroup Q frequencies in each population sectors are Q-P36* 0.6% & Q-M3 0.1% in White American, Q-P36* 3.8% & Q-M3 7.9% in Hispanic American, Q-P36* (xM3) 0.2% in African American, Q-P36* 31.2% & Q-M3 26.9% in Native American.[16] So, recalculated by the population weights of each sector, the frequency of Q-M242 in the US reaches 3.1% as of 2010. (This figure will rise up, as Hispanic population in the US increases.)

Meso and South America

Haplogroup Q-M242 has been found in approximately 94% of Indigenous peoples of Mesoamerica and South America.[17] Q-M242 built many ancient cultures and civilizations such as Tiwanaku, Caral(Norte Chico civilization), Maya, Inca, Aztec, and so on.

As a result of five centuries of wide-scale biological mestizaje, or miscegenation, between indigenous Americans and European immigrants, today in Mesoamerica and South America the frequencies of Q-M242 (mostly M3) among the whole male population of each country are lower than indigenous Amerincan populations, but nonetheless run far higher than in the population of North America.

The frequencies of Q among the whole male population (inclusive of all mixed-race and mono-racial groups) of each country reach as follow:

Based on the data above, the average frequency in the whole male population of Mesoamerica and South America is estimated to be about 18%.

Asia

Q-M242 originated in Asia (Altai regions), and is widely distributed across it.[2] Q-M242 is found in Russia, Siberia (Kets,[31] Selkups, Siberian Yupik people, Nivkhs, Chukchi people,[32] Yukaghirs, Tuvans,[33] Altai people,[34] Koryaks, etc.), Mongolia,[35] China,[36][37] Uyghurs,[35] Tibet,[38] Korea, Japan, Indonesia,[39] Vietnam,[40] Thailand,[41] India,[42] Pakistan,[42] Afghanistan, Iran,[43] Iraq, Saudi Arabia, Turkmenistan, Uzbekistan, and so on. (For details, see below.)

North Asia

In Siberia, the regions between Altai and Lake Baikal, which are famous for many prehistoric cultures and as the most likely birthplace of haplogroup Q, exhibit high frequencies of Q-M242. In a study (Dulik 2012),[44] Q-M242 (mostly Q-M346 including some Q-M3) has been found in 24.3% (46/189: 45 Q-M346, 1 Q-M25) of all Altaian samples. Among them, Chelkans show the highest frequency at 60.0% (15/25: all Q-M346), followed by Tubalars at 41% (11/27: 1 Q-M25, 10 Q-M346) and Altaians-Kizhi at 17% (20/120). In a former study, Q-M242 is found in 4.2% of southern Altaians and 32.0% of northern Altaians with the highest frequency of 63.6% in Kurmach-Baigol (Baygol). The frequency reaches 13.7% (20/146) in the whole samples.[34] In another study,[45] the frequency rises up to 25.8% (23/89: all Q-M346) in Altaians. Based on the results of these studies, the average frequency of Q-M242 in Altaians is about 21%.

Tuva, which is located on the east side of Altai Republic and west of Lake Baikal as well as on the north side of Mongolia, shows higher frequency of Q-M242. It is found in 16%[33]~38.0% (41/108)[45] of Tuvans. Also, Todjins (Tozhu Tuvans) in eastern Tuva shows the frequency at 38.5% (10/26, all Q-M346).[45] So, the average frequency of Q-M242 in Tuva is about 31%.

The highest frequencies of Q-M242 in Eurasia are witnessed in Kets (central Siberia) at 93.8% (45/48) and in Selkups (north Siberia) at 66.4% (87/131).[31] Russian ethnographers believe that their ancient places were farther south, in the area of the Altai and Sayan Mountains[2] (Altai-Sayan region). Their populations are currently small in number, being just under 1,500 and 5,000 respectively. In linguistic anthropology, the Ket language is significant as it is currently the only surviving one in the Yeniseian language family which has been linked by some scholars to the Native American Na-Dené languages[46] and, more controversially, the language of the Huns. (See: L. Lieti, E. Pulleybank,[47] E. Vajda,[48] A. Vovin,[49] etc.) Q-M346 is also found at lower rates in Sojots (7.1%, Q-M346), Khakassians (6.3%, Q-M346), Kalmyks (3.4%, Q-M25, Q-M346)[45] and Khanty,[50] and so on.

In far eastern Siberia, Q-M242 is found in 35.3% of Nivkhs (Gilyaks) in the lower Amur River, and 33.3% of Chukchi people and 39.2% of Siberian Yupik people in Chukotka (Chukchi Peninsula).[32] It is found in 30.8% of Yukaghirs who live in the basin of the Kolyma River, which is located northwest of Kamchatka.[33] It is also found in 15% (Q1a* 9%, Q-M3 6%) of Koryaks in Kamchatka.[20]

East Asia

In some studies, various subgroups of Q-M242 are observed in Mongolia. Q1a2-M346 (mostly Q-L330) occupies 1.4[20]~3.1%[43] of Mongols (1/2~2/3 among Q samples), followed by Q1a1a1-M120 (0.25[20]~1.25%[43]), Q1a1b-M25 (0.25[20]~0.63%[43]), Q1b-M378. In another study, Q is found in 4% of Mongols.[17] Based on these studies, the average frequency of Q-M242 in Mongols is estimated to be about 4~5%.

However, most of Q-M242 people in East Asia belong to subclade Q-M120, which distributes most intensively across northern China (the provinces of which the capitals locate northern to Huai River-Qin Mountains line). Q-M242 ranged from 4~8% in northwest China (Xinjiang, Gansu, Shaanxi), north China (Shanxi, Hebei), central China (Henan), and upper east China (Shandong) to 3~4% in northeast China (Manchuria). The average frequency of Q-M242 in northern China is around 4.5%. However, it decreases to about 2% in southern China.[36][37] In a study published in 2011, researchers have found Q-M242 in 3.3% (12/361) of the samples of unrelated Han-Chinese male volunteers at Fudan University in Shanghai with the origins from all over China, though with the majority coming from east China.[51]

Q-M242 is found in about 9.5% of Uyghurs,[52] with Q-M346 occupying the half and followed by Q1*, Q-M120, Q-M378, Q-M25. It is also found in approximately 3.2% (5/156 : 2 Q-M120, 3 Q-M346) of males in Tibet.[38]

It is found in about 1.9% of South Koreans,[53][54][55] showing the highest frequency in Seoul and Gyeonggi Province at 2.7% and decreasing ones to the south (Kim 2010). It is about in 0.5% of Japanese[56] and in 0.3%[41]~1.2%[57] of Taiwanese.

Subclade Q1b-M378 is also found in China and its neighboring countries at very low frequencies. It exists throughout all Mongolia, with rare examples in Japan.[58]

Southeast Asia

Haplogroup Q shows low frequencies in Southeast Asia. In a study,[39] the frequencies of haplogroup Q is 5.4% (2/37) in Indonesia, 3.1% (2/64) in the Philippines, 2.5% (1/40) in Thailand. However, other studies show 0% or near 0% frequencies in those countries.[41] In the case of Vietnam, the frequency is 7% in a study,[59] but 0% or under 1% in other studies.[39][41] So, it is hard to define average frequencies. But, it is safe to say that southeast Asia generally shows very low frequency (about 0.5%~1%) of Q-M242, and the continental regions show higher frequencies than island ones.

Only some regions and ethnic groups in the continent show high frequencies. Q-M242 is found in 2.8% (3/106, all Q-M346) in Myanmar, and all the Q samples are concentrated in Ayeyarwady (2/11) and Bago (1/14) regions in southwest Myanmar.[60] And, Q-M242 is found in 55.6% (15/27) in the Akha tribe in northern Thailand.[41] The Akha are known to have moved from southern China (east Tibet and Yunnan) to Southeast Asia over the past centuries, and to have originated from a northern area such as Mongolia or Manchuria a long time ago.[61]

Central Asia

In Central Asia, the southern regions show higher frequencies of Q than the northern ones.

In the northern regions, Q-M242 is found in about 2%[62]~6%[63][64] (average 4%) of Kazakhs. It is found in about 2% of Kyrgyz people.[43][63][64]

In the southern regions, Q-M242 is found in 5%[65]~6%[63][64] of Tajiks (Tajikistan), and in about 8.3% of Uzbeks[43][66] In case of Turkmenistan, the frequency is not clear, but it can reach about 40% in light of the frequencies (34%~43%) in Turkmens of Afghanistan and Iran who live in the areas adjacent to Turkmenistan.

Southwest Asia

Southwest Asia exhibits high frequencies of Q in northern Iran, and gradually lowering ones to the southwest.

Q-M242 accounts for 5.5% (52/938) in Iran according to Grugni 2012, which shows a large and well allocated sampling. The Q samples (52) in the study consist of various subclades such as Q* (3), Q-M120 (1), Q-M25 (30), Q-M346 (8), Q-M378 (10). The highest frequency is at 42.6% (29/68, all Q-M25) in Turkmens of Golestan, followed by 9.1% in Isfahan (Persian people), 6.8% in Khorasan (Persian people), 6% in Lorestan (Luristan, Lurs), 4.9% in Azarbaijan Gharbi (5.1% of Assyrians and 4.8% of Azeris), 4.5% in Fars (Persian people), and so on.[67] Turkmens are known as the descendants of Oghuz Turks who built many Turkic empires and dynasties. Other studies also show similar frequencies.[68][69][70]

In a study (Zahery 2011), the frequency of Q is 1.9% (3/154: all Q-M378) in Iraqis (x Marsh Arabs), and 2.8% (4/143: 1 Q-M25, 3 Q-M378) in Marsh Arabs who are known as the descendants of ancient Sumerians.[71][72] So, there have been many controversies over the connections between Sumerians and ancient Bolivian (and Peruvian) cultures.

Approximately 2.5% (4/157: 3 Q*, 1 Q-M346) of males in Saudi Arabia belong to haplogroup Q. It also accounts for 1.8% (3/164: 2 Q*, 1 Q-M346) in the United Arab Emirates and 0.8% (1/121: Q*) in Oman peoples.[73][74]

Haplogroup Q-M242 has also been found in 1.1% (1/87, Q-P36) Syrians[59] and 2.0% (18/914, 14 Q*, 4 Q-M25) in Lebanese.[75]

Approximately 2% (10/523: 9 Q*, 1 Q-M25) of males in Turkey belong to haplogroup Q.[76] In a study (Gokcumen 2008), it was found that among Turks who belong to the Afshar tribe (one of Oghuz Turks) haplogroup Q-M242 is seen with a prevalence of 13%.[77]

South Asia

Q-M242 accounts for 6.9% of Afghans in a study (Haber 2012). In this study, 18.4% (9/49: 8 Q*, 1 Q-M346) of Pashtuns, the largest ethnic group in Afghanistan, turned out to be haplogroup Q.[78] In another study (Cristofaro 2013) with a large sampling, the frequency of Q rises to 8.9% (45/507). In this study, Turkmens of Jowzjan Province which is neighboring to Turkmenistan show the highest frequency at 33.8% (25/74: 23 Q-M25, 2 Q-M346), followed by Uzbeks at 8.7% (11/144: 6 Q*, 1 Q-M25, 4 Q-M346).[43] If the results of these studies are aggregated and recalculated by population weights of each ethnic group, the frequency of Q in Afghan males will be 6.3%.[79]

In Pakistan at the eastern end of the Iranian Plateau, the frequency of haplogroup Q-M242 is about 2.2% (14/638)[80]~3.4% (6/176).[81]

In a study (Sharma2007), Q-M242 is observed in 2.38% (15/630) of Indian people belonging to different regions and social categories. What is interesting is 14/15 samples do not belong to any known subgroups of Q-M242, with 4 among them showing novel (Indian-specific) ‘ss4bp’ allele under Q-MEH2. This study also reflects the results of some former studies (Sengupta 2006, Seielstad 2003). And, the accumulated result (frequency) of 3 studies is turned out to be 1.3% (21/1615), with 11 out of 21 Q samples ranked as high caste in social category.[5] (For more information, see Y-DNA haplogroups in South Asian populations)

In another regional studies on India, Q-M242 is found in 2.8% (8/284, all Q-M346) of Gujarat (Western India) people[82] and in 6.1% (3/49) of Hindus in New Delhi, the capital of India.[83]

1.2% of Nepalese people in Kathmandu,[38] the capital of Nepal, are in Q-M242.

In a study in which Q-M242 is just classified in P* group, P* (x R1, R2) accounts for 9.7% (23/237: Chakma 13/89, Marma 4/60, Tripura 6/88) in three ethnic groups of Bangladesh.[84] In many cases, all or most of P* (x R1, R2) means Q-M242, and thus most of P* (9.7%) samples in that study can be estimated to be Q-M242.

3.3% of Sri Lankans[59] are also in Q-M242.

Europe

Q-M242 is distributed across most European countries at low frequencies, and the frequencies decrease to the west and to the south.

Central- and Eastern Europe

In Central- Eastern Europe, Q-M242 comprises about 1.7% of males. Q-M242 is found in about 2% of Russians,[85] 1.5% of Belarusians,[86] 1.3% of Ukrainians[87] 0.5 [88] 1.3% of Poles (Poland),[89] 2% of Czechs,[90] 1.5% of Slovaks,[91] about 2.2% of Hungarians,[92][93] 1.2% of Romanians,[94] 0.8% of Moldovans,[95] and 0.5% (4/808: 2 Q-M378, 1 Q-M346, 1 Q-M25) of Bulgarians[96] On the other hand, 3.1% of Székelys from Transylvania (who have claimed to be descendants of Attila’s Huns) turned out to be P* (xR1-M173),[97] which virtually means Q-M242. In a related DNA Project of FT-DNA, the frequency of Q-M25 in Székelys (Szeklers) reaches 4.3%.[98][99]

The Caucasus region shows a frequency at 1.2% in a study,[69] but it may reach over 4% in Azerbaijan, in that 4.9% of the neighboring Iranian Azerbaijanis harbor Q-M242.[68] It is 1.3% in Georgians and Armenians respectively, and Armenian subclades consist of Q-M378 (L245), Q-M346, and Q-M25.[100]

Northern Europe

In Northern Europe, haplogroup Q comprises about 2.5% of males. According to the Swedish Haplogroup Database, 4.1% (27/664, as of Jan 2016) of Swedish males belong to Q-M242. About 2/3 of the samples analyzed subclades in detail belong to Q1a2b-F1161/L527 and about 1/3 are in Q1a2a-L804. By county, they are distributed intensively in the southern region (Götaland,: not to be confused with Gotland), and rarely to the north. The highest frequency of Q is shown at 20% in Halland County, followed by 14.3% in Jönköping, 12.5% in Kronoberg County, 12.5% in Västmanland, 8.7% in Gävleborg County, 4.3% in Västra Götaland County, 4% in Stockholm, 3.9% in Skåne County(Scania), and so on.[101] If recalculated by county-population weights, the frequency of Q in Sweden reaches 4.7%.

In Norway, Q-M242 is found in about 2.6% (~4%[102]) of males, with Q-L804 being more common than Q-F1161/L527.[103] It is observed among 1.6% of males in Denmark, 3% in the Faroe Islands (known to be related to Vikings).[104] In an article (Helgason et al.) on the haplotypes of Icelanders, 7.2% (13/181) of males in Iceland are labelled as R1b-Branch A, but they are actually Q-M242.[102][105] On the other hand, it is 0.2% in Finland,[106] 4.6% in Latvia,[107] 1.1% in Lithuania,[108] 0.5% in Estonia.

Western Europe

In Western Europe, Q-M242 is observed at very low frequencies, around 0.5% in most of the countries, such as Germany, France, United Kingdom, etc., but some regions show a little higher. It is 2.1% in Switzerland,[109] and it reaches 5.1% in Lyon (Rhône-Alpes) region of France.[110] It is about 4% in Shetland of northernmost Britain, with a place in it showing the highest figure at 8%. Shetland has been known to be a settlement of Vikings. And, surprisingly, Q-M242 in Shetland (also in some areas of Scandinavia, Faroe Islands, Iceland, and the Great United Kingdom) has turned out to be generically closely linked to the Q-M242 in Central Asia, . Also, Shetland (Norse) Q-M242 is revealed to be linked to some Q-M242 of Azeris (Azerbaijan).[102]

Southern Europe

Southern Europe also shows low frequencies of Q around 0.5%~1%, but some regions exhibits different figures. It is 1.9% in mainland Croatia, but it reaches 14.3% (13/91) in Hvar Islands and 6.1% (8/132) in Korčula.[110] Also, it is about 0.6% in Italy, but it rises to 2.5% (6/236) in Sicily, where it reaches 16.7% (3/18) in Mazara del Vallo region, followed by 7.1% (2/28) in Ragusa, 3.6% in Sciacca,[111] and 3.7% in Belvedere Marittimo.[112]

On the other hand, according to a study (Behar 2004), 5.2% (23/441) of Ashkenazi Jews males belong to haplogroup Q-P36.[113] This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245. Also, 2.3% (4/174)[114]~5.6% (3/53)[115] of Sephardi Jews are in haplogroup Q.

Africa

Haplogroup Q is rarely found across North Africa. It is observed in 0.7% (1/147),[74] of Egyptians and in 0.6% (1/156)[69] of Algerian people. Surprisingly, it is also witnessed in 0.8% (3/381, all Q-M346) of males from Comoros which is located in between East Africa and Madagascar.

To combine the data above, Q-M242 is estimated to be in about 3.1% of males of the world.

Subclade distribution

Y-DNA Q samples from ancient sites

See also

Populations

Y-DNA Q-M242 subclades

Y-DNA backbone tree

Phylogenetic tree of human Y-chromosome DNA haplogroups [χ 1][χ 2]
"Y-chromosomal Adam"
A00 A0-T [χ 3]
A0 A1 [χ 4]
A1a A1b
A1b1 BT
B CT
DE CF
D E C F
F1  F2  F3  GHIJK
G HIJK
IJK H
IJ   K
I J    LT [χ 5]  K2
L T [χ 6] NO [χ 7] K2b [χ 8]     K2c  K2d  K2e [χ 9]
N   O   K2b1 [χ 10]     P
K2b1a [χ 11]   K2b1b  K2b1c  M P1 P2
K2b1a1   K2b1a2   K2b1a3 S [χ 12] Q   R
  1. ↑ Van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation. 35 (2): 187–91. doi:10.1002/humu.22468. PMID 24166809.
  2. ↑ International Society of Genetic Genealogy (ISOGG; 2015), Y-DNA Haplogroup Tree 2015. (Access date: 1 February 2015.)
  3. ↑ Haplogroup A0-T is also known as A0'1'2'3'4.
  4. ↑ Haplogroup A1 is also known as A1'2'3'4.
  5. ↑ Haplogroup LT (L298/P326) is also known as Haplogroup K1.
  6. ↑ Between 2002 and 2008, Haplogroup T (M184) was known as "Haplogroup K2" – that name has since been re-assigned to K-M526, the sibling of Haplogroup LT.
  7. ↑ Haplogroup NO (M214) is also known as Haplogroup K2a (although the present Haplogroup K2e was also previously known as "K2a").
  8. ↑ Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.
  9. ↑ Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a, also known as Haplogroup NO).
  10. ↑ Haplogroup K2b1 (P397/P399) is similar to the former Haplogroup MS, but has a broader and more complex internal structure.
  11. ↑ Haplogroup K2b1a has also been known as Haplogroup S-P405.
  12. ↑ Haplogroup S (S-M230), also known as K2b1a4, was previously known as Haplogroup K5.

References

Citations

  1. ↑ Fagundes, Nelson J. R.; Kanitz, Ricardo; Eckert, Roberta; Valls, Ana C. S.; Bogo, Mauricio R.; Salzano, Francisco M.; Smith, David Glenn; Silva, Wilson A.; Zago, Marco A.; Ribeiro-Dos-Santos, Andrea K.; Santos, Sidney E. B.; Petzl-Erler, Maria Luiza; Bonatto, Sandro L. (2008). "Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas" (pdf). American Journal of Human Genetics. 82 (3): 583–592. doi:10.1016/j.ajhg.2007.11.013. PMC 2427228Freely accessible. PMID 18313026. Retrieved 2009-11-19. Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages
  2. 1 2 3 4 5 6 7 8 9 Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2004). "High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas" (PDF). Molecular Biology and Evolution. 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095.
  3. 1 2 YFull YTree v4.02
  4. 1 2 Y-DNA Haplogroup Q and its Subclades - 2016
  5. 1 2 3 Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q-M242 in India". BMC Evol. Biol. 7 (1): 232. doi:10.1186/1471-2148-7-232. PMC 2258157Freely accessible. PMID 18021436.
  6. ↑ Proposed Tree
  7. ↑ Krahn, Thomas. "FTDNA Draft Y-DNA Tree (AKA YTree)". Family Tree DNA. Retrieved 2012. Check date values in: |access-date= (help)
  8. ↑ Karafet, T. M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805Freely accessible. PMID 18385274.
  9. ↑ "Y-DNA Haplotree". Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.
  10. ↑ That is because it is a value for the STR DYS435 with a value of 8--> 9 within haplogroup Q-M242 and the trend is to include only binary markers in phylogenetic trees. However, these are from studies where all current branches of the Q-M242 tree have not been tested. The problematic phylogeny sampling of early studies has been demonstrated by subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.
  11. ↑ Malhi, RS; Gonzalez-Oliver, A; Schroeder, KB; Kemp, BM; Greenberg, JA; Dobrowski, SZ; Smith, DG; Resendez, A; Karafet, T; Hammer, M; Zegura, S; Brovko, T (2008). "Distribution of Y chromosomes among native North Americans: a study of Athapaskan population history". Am. J. Phys. Anthropol. 137: 412–24. doi:10.1002/ajpa.20883. PMC 2584155Freely accessible. PMID 18618732.
  12. ↑ "Frequency Distribution of Y-DNA Haplogroup Q M3". GeneTree. 2010. Retrieved 2010-01-30.
  13. ↑ "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature Publishing Group. 2010. pp. 463, 757–762. doi:10.1038/nature08835. Retrieved 2010-02-11.
  14. ↑ Katharina Olofsson, Jill; et al. "Peopling of the North Circumpolar Region – Insights from Y Chromosome STR and SNP Typing of Greenlanders". PLOS ONE. 10: e0116573. doi:10.1371/journal.pone.0116573.
  15. ↑ Population Estimates
  16. ↑ Hammer; et al. (Dec 2006). "'Population structure of Y chromosome SNP haplogroups in the United States and forensic implications for constructing Y chromosome STR databases'". Forensic Sci Int. 164 (1): 45–55. doi:10.1016/j.forsciint.2005.11.013.
  17. 1 2 Bortolini, M; Salzano, F; Thomas, M; Stuart, S; Nasanen, S; Bau, C; Hutz, M; Layrisse, Z; et al. (2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". The American Journal of Human Genetics. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678Freely accessible. PMID 12900798.
  18. ↑ Vullo, Carlos; et al. (2014). "'Association between Y haplogroups and autosomal AIMs reveals intra-population substructure in Bolivian populations'". Int J Legal Med. 129: 673–680. doi:10.1007/s00414-014-1025-x.
  19. ↑ Söchtig, Jens; et al. (2015). "Genomic insights on the ethno-history of the Maya and the 'Ladinos' from Guatemala". BMC Genomics. 16. doi:10.1186/s12864-015-1339-1. => Guatemala population consists of about 40% Natives (Mayans)+60% Ladinos. According to this paper, 89% of Mayan and 25% of Ladinos belong to Y-DNA Q. Thus, 40*0.89+60*0.25=50.6%
  20. 1 2 3 4 5 6 7 8 Battaglia; et al. (2013). "The First Peopling of South America: New Evidence from Y-Chromosome Haplogroup Q". PLOS ONE. 8: e71390. doi:10.1371/journal.pone.0071390.
  21. ↑ Gaviria, A.; et al. (2013). "Characterization and Haplotype analysis of 11 Y-STR loci in Ecuadorian population". Forensic Sci. Int. Gene. Suppl. doi:10.1016/j.fsigss.2013.10.15.
  22. ↑ Martínez-Cortés, G; et al. (2012). "Admixture and population structure in Mexican-Mestizos based on paternal lineages". J. Hum. Genet. 57: 568–74. doi:10.1038/jhg.2012.67. PMID 22832385.
  23. ↑ Lovo-Gómez, J; et al. (Sep 2007). "'The genetic male legacy from El Salvador'". Forensic Sci Int. 171 (2-3): 198–203. doi:10.1016/j.forsciint.2006.07.005.
  24. ↑ Grugni (2015). "Exploring the Y Chromosomal Ancestry of Modern Panamanians". PLOS ONE. 10: e0144223. doi:10.1371/journal.pone.0144223.
  25. ↑ Rojas, Win; et al. (2010). "'Genetic Make Up and Structure of Colombian Populations by Means of Uniparental and Biparental DNA Markers'". American Journal of Physical Anthropology. 143: 13–20. doi:10.1002/ajpa.21270. PMID 20734436.=> (DANE, 2006) 86% of the whole Colombian population self-reported as of Mixed Ancestary, 3.4% as Native American, 10.5% as African-Columbian. In this paper, 12% (114/954) of MA, 95.7% (135/141) of NA, and 23.8% (5/21) of AC are turned out to be Y-DNA Q. Thus, 86*0.12+3.4*0.957+10.5*0.238=16.1%
  26. ↑ Núñez, Carolina; et al. (2012). "'Y chromosome haplogroup diversity in a Mestizo population of Nicaragua'". Forensic Sci. Int. Genet. 6: e192–e195. doi:10.1016/j.fsigen.2012.06.011. The author revised his previous paper, genotyping 2 more samples as haplogroup Q by Y-SNP test.
  27. ↑ Corach, Daniel; et al. (2010). "Inferring Continental Ancestry of Argentineans from Autosomal, Y-Chromosomal and Mitochondrial DNA". Annals of Human Genitics. 74 (1): 65–76. doi:10.1111/j.1469-1809.2009.00556.x.
  28. ↑ Ramallo; et al. (Dec 2009). "Comparison of Y-chromosome haplogroup frequencies in eight Provinces of Argentina". Forensic Science International Genetics Supplement Series. 2 (1): 431–432. doi:10.1016/j.fsigss.2009.08.047.
  29. ↑ http://www.fsigeneticssup.com/article/S1875-1768 (08)00138-8/fulltext(To read this document, allow cookies on your internet option), 5 out of 100 samples in the Y-STR table can be classified as haplogroup Q-M3.
  30. ↑ Palha, T.; et al. (2012). "'Disclosing the Genetic Structure of Brazil through Analysis of Male Lineages with Highly Discriminating Haplotypes'". PLOS ONE. 7 (7): e40007. doi:10.1371/journal.pone.0040007.=> about 80 out of 2,024 (3.95%) samples in the paper collected from all the regions of Brazil can be classified as Y-DNA Q.
  31. 1 2 T. M. Karafet, 'High Levels of Y-Chromosome Differentiation among Native Siberian Populations and the Genetic Signature of a Boreal Hunter-Gatherer Way of Life', Human Biology, December 2002, v. 74, no. 6, pp. 761–789
  32. 1 2 Jeffrey, T.; et al. (Jan 2002). "Lell et al. The Dual Origin and Siberian Affinities of Native American Y Chromosomes". Am J Hum Genet. 70 (1): 192–206. doi:10.1086/338457. The SNPs used in the paper are P-M45, R1a1-M17, Q1a2-M3, and other xP-M45 SNPs. And the author mentions that, among ethnic groups in the paper, R1-M173 is harbored only in some eastern Siberian Udegeys and Koryaks and Native Americans. Also, R2 (distributed in India and its neighbours) cannot be found in far east Siberia. Thus, P-M45 except some samples mentioned above virtually means Q-M242 (xM3). In the paper, 35.3% of Nivkhs and 20.8% of Chukchi people and 18.2% of Siberian Eskimos are shown in P-M45, and 12.5% of Chukchis and 21.2% of Siberian Eskimos are in Q-M3. All of them can be estimated to be in haplogroup Q.
  33. 1 2 3 Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’Jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts". Human Genetics. 120 (3): 334–353. doi:10.1007/s00439-006-0213-2. PMID 16845541.
  34. 1 2 Kharkov, V. N.; Stepanov, V. A.; Medvedeva, O. F.; Spiridonova, M. G.; Voevoda, M. I.; Tadinova, V. N.; Puzyrev, V. P. (2007). "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups". Genetika. 43 (5): 675–687.
  35. 1 2 Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). "Dual origins of the Japanese: Common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics. 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082.
  36. 1 2 3 Wen B, Li H, Lu D, et al. (September 2004). "Genetic evidence supports demic diffusion of Han culture". Nature. 431 (7006): 302–5. doi:10.1038/nature02878. PMID 15372031. Supplementary Table 2: NRY haplogroup distribution in Han populations
  37. 1 2 3 4 Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter; et al. (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas". Human Genetics. 107 (6): 582–90. doi:10.1007/s004390000406. PMID 11153912.
  38. 1 2 3 4 5 Gayden, Tenzin; et al. (May 2007). "'The Himalayas as a Directional Barrier to Gene Flow'". Am J Hum Genet. 80 (5): 884–894. doi:10.1086/516757. PMC 1852741Freely accessible. PMID 17436243.
  39. 1 2 3 Kim, Soon-Hee; et al. (2011). "High frequencies of Y-chromosome haplogroup O2b-SRY465 lineages in Korea: a genetic perspective on the peopling of Korea". Investigative Genetics. 2: 10. doi:10.1186/2041-2223-2-10.
  40. 1 2 Karafet, Tatiana M.; Hallmark, Brian; Cox, Murray P.; et al. (2010). "Major East–West Division Underlies Y Chromosome Stratification across Indonesia". Mol. Biol. Evol. 27 (8): 1833–1844. doi:10.1093/molbev/msq063. PMID 20207712.
  41. 1 2 3 4 5 Trejaut, J.A. (2014). "Taiwan Y-chromosomal DNA variation and its relationship with Island Southeast Asia". BMC Genetics. 15: 77. doi:10.1186/1471-2156-15-77.
  42. 1 2 3 The Y Chromosome Consortium 2008
  43. 1 2 3 4 5 6 7 Cristofaro; et al. (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLOS ONE. 8: e76748. doi:10.1371/journal.pone.0076748.
  44. ↑ Dulik, M C (Feb 2012). "Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaian". Am J Hum Genet. 90 (2): 229–246. doi:10.1016/j.ajhg.2011.12.014.
  45. 1 2 3 4 Malyarchuk, Boris; et al. (2011). "Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a". Journal of Human Genetics. 56: 583–588. doi:10.1038/jhg.2011.64. PMID 21677663.
  46. ↑ E. J. VAJDA, "Siberian Link with Na-Dene Languages." The Dene–Yeniseian Connection, ed. by J. Kari and B. Potter(2010), pp.33–99, Anthropological Papers of the University of Alaska, new series, vol. 5(2010), Fairbanks: University of Alaska Fairbanks, Department of Anthropology
  47. ↑ E. G. Pulleyblank, "The consonontal system of old Chinese" [Pt 1], Asia Major, vol. IX (1962), pp. 1–2
  48. ↑ E. J. Vajda, Yeniseian Peoples and Languages: A History of Yeniseian Studies with an Annotated Bibliography and a Source Guide (2013, Oxford/New York, Routledge) pp.103-106, etc.
  49. ↑ "Did the Xiong-nu speak a Yeniseian language?". Central Asiatic Journal. 44 (1): 87–104. 2000.
  50. ↑ Mirabal S, Regueiro M, Cadenas AM, et al. (March 2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". Eur. J. Hum. Genet. 17 (10): 1260–73. doi:10.1038/ejhg.2009.6. PMC 2986641Freely accessible. PMID 19259129.
  51. ↑ Yan, Shi; Chuan-; Wang, Chao; Li, Hui; et al. (2011). "An updated tree of Y-chromosome Haplogroup O and revised phylogenetic positions of mutations P164 and PK4". European Journal of Human Genetics. 19 (9): 1013–1015. doi:10.1038/ejhg.2011.64. PMC 3179364Freely accessible. PMID 21505448.
  52. ↑ Shan; et al. (Sep 2014). "'Genetic polymorphism of 17 Y chromosomal STRs in Kazakh and Uighur populations from Xinjiang, China'". Int J Legal Med. 128 (5): 743–4. doi:10.1007/s00414-013-0948-y.
  53. ↑ Kim, Soon-Hee; et al. (Nov 2010). "'Y chromosome homogeneity in the Korean population". Int J Legal Med. 124 (6): 653–7. doi:10.1007/s00414-010-0501-1.
  54. ↑ Jin Park, Myung; et al. (2012). "Understanding the Y chromosome variation in Korea-relevance of combined haplogroup and haplotype analyses". International Journal of Legal Medicine. 126 (4): 589–599. doi:10.1007/s00414-012-0703-9.
  55. ↑ The frequencies of Q-M242 shown in both studies (Kim2010, Park2012) are 1.4% (7/506, Kim) and 1.8% (13/706, Park) respectively. But, if recalculated by regional population weights, the adjusted frequencies reach 1.87% (Kim) and 1.91% (Park) respectively, converging to 1.9%.
  56. 1 2 Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms". Annals of Human Genetics. 71 (4): 480–495. doi:10.1111/j.1469-1809.2006.00343.x. PMID 17274803.
  57. 1 2 Wang C-C, Wang L-X; Shrestha, R; Zhang, M; Huang, X-Y; et al. (2014). "Genetic Structure of Qiangic Populations Residing in the Western Sichuan Corridor". PLoS ONE. 9 (8): e103772. doi:10.1371/journal.pone.0103772.
  58. ↑ Y-chromosome lineage in five regional Mongolian populations Toshimichi Yamamotoemail, Tomoki Senda, Daiki Horiba, Masayoshi Sakuma, Yuuka Kawaguchi, Yuuichi Kano
  59. 1 2 3 Karafet, TM; et al. (Feb 2005). "Balinese Y-chromosome perspective on the peopling of Indonesia: genetic contributions from pre-neolithic hunter-gatherers, Austronesian farmers, and Indian traders". Hum Biol. 77 (1): 93–114. doi:10.1353/hub.2005.0030.
  60. ↑ Peng, Min-Sheng; et al. (Aug 2014). "Retrieving Y chromosomal haplogroup trees using GWAS data". Eur J Hum Genet. 22 (8): 1046–1050. doi:10.1038/ejhg.2013.272.
  61. ↑ ”The Akha are an Asian indigenous group originally from Mongolia.” The Akha’s legend says that their ancestors came to southern China across many mountains and large rivers. So, their original place is believed as Mongolia or Manchuria.
  62. ↑ Turspekov; et al. (2012). "The Kazakhstan DNA project hits first hundred Y-profiles for ethnic Kazakhs". The Russian Journal of Genetic Genealogy. 2: 1.
  63. 1 2 3 4 5 Wells RS, Yuldasheva N, Ruzibakiev R, et al. (August 2001). "The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMC 56946Freely accessible. PMID 11526236. Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region
  64. 1 2 3 Seielstad, Mark; et al. (Sep 2003). "A Novel Y-Chromosome Variant Puts an Upper Limit on the Timing of First Entry into the Americas". Am J Hum Genet. 73 (3): 700–705. doi:10.1086/377589.
  65. ↑ Malyarchuk, B; et al. (Jan 2013). "Y-chromosome variation in Tajiks and Iranians". Ann Hum Biol. 40 (1): 48–54. doi:10.3109/03014460.2012.747628.
  66. ↑ Karafet; et al. (Sep 2001). "Paternal Population History of East Asia: Sources, Patterns, and Microevolutionary Processes". Am J Hum Genet. 69 (3): 615–628. doi:10.1086/323299.
  67. 1 2 Grugni, Viola; et al. (2012). "Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians". PLOS ONE. 7: e41252. doi:10.1371/journal.pone.0041252. PMC 3399854Freely accessible. PMID 22815981.
  68. 1 2 Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ (2006). "Iran: tricontinental nexus for Y-chromosome driven migration". Hum. Hered. 61 (3): 132–43. doi:10.1159/000093774. PMID 16770078.
  69. 1 2 3 Bekada, Asmahan; et al. (2013). "Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape". PLOS ONE. 8 (2): e56775. doi:10.1371/journal.pone.0056775.
  70. ↑ The frequency of Q is 4% (6/150, all Q-M25) in Regueiro 2006, in which it is 9.1% (3/33) in north Iran and 2.6% (3/117) in south Iran. But, since more people live in the northern regions, if recalculated by population weights, the frequency will reach about 6%. It is also 6.2% (35/566) in Bekada 2013 with a large-scale sampling.
  71. ↑ Al-Zahery, Nadia; et al. (2011). "In search of the genetic footprints of Sumerians: a survey of Y-chromosome and mtDNA variation in the Marsh Arabs of Iraq". BMC Evolutionary Biology. 11: 288. doi:10.1186/1471-2148-11-288.
  72. ↑ According to scholars, early Sumerians called themselves 'black-headed people', and spoke an agglutinative language with the word order of SOV, which was quite different from common Semitic or Indo-European languages. Among Semitic languages, only Akkadian had SOV word order, which is due to the influence of the Sumerian language.(For more information, see Sumer, Sumerian Language, Akkadian language, and so on.) On the other hand, surprisingly, some ancient writings found in Bolivia such as Pokotia Monolith, have been interpreted with the Proto-Sumerian language. http://www.faculty.ucr.edu/~legneref/biados/texts/WintersPokotia.htm
  73. 1 2 Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (March 2008). "Y-chromosome diversity characterizes the Gulf of Oman". Eur. J. Hum. Genet. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816.
  74. 1 2 3 Abu-Amero, Khaled K.; Hellani, Ali; Gonzalez, Ana M.; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics. 10 (1): 59. doi:10.1186/1471-2156-10-59. PMC 2759955Freely accessible. PMID 19772609.
  75. ↑ Zalloua PA, Xue Y, Khalife J, et al. (April 2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". Am. J. Hum. Genet. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286Freely accessible. PMID 18374297.
  76. 1 2 Cinnioğlu C, King R, Kivisild T, et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639.
  77. ↑ Gokcumen, Omer (2008). Ethnohistorical and Genetic Survey of Four Central Anatolian Settlements. University of Pennsylvania. ISBN 978-0-549-80966-1. Retrieved May 13, 2014.
  78. 1 2 Haber M, Platt DE, Ashrafian Bonab M, Youhanna SC, Soria-Hernanz DF, et al. (2012). "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events". PLoS ONE. 7 (3): e34288. doi:10.1371/journal.pone.0034288. PMC 3314501Freely accessible. PMID 22470552.
  79. ↑ To aggregate the results of Haber 2012 and Cristofaro 2013, the frequency of each ethnic group is 33.3% (25/75) in Turkmens, followed by 8.1% (11/136) in Pashtuns, 7.6% in Uzbeks (11/144), 4.4% in Hazara, 3.0% in Tajiks. Currently, Afghans consist of Pashtun 42%, Tajik 27%, Hazara 9%, Uzbek 9%, Turkmen 3%, others 10%. Thus, if recalculated by population weights of ethnic groups, the frequency of Q in Afghans will be 6.3%.
  80. ↑ Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2007). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics. 15 (1): 121–126. doi:10.1038/sj.ejhg.5201726. PMC 2588664Freely accessible. PMID 17047675.
  81. 1 2 3 4 5 Sengupta, Sanghamitra; Zhivotovsky, Lev A.; King, Roy; Mehdi, S.Q.; Edmonds, Christopher A.; Cheryl-, Cheryl-Emiliane T.; Chow, Emiliane T.; Lin, Alice A.; et al. (2006). "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists". The American Journal of Human Genetics. 78 (2): 202–221. doi:10.1086/499411. PMC 1380230Freely accessible. PMID 16400607.
  82. ↑ Khurana, P; et al. (2014). "Y Chromosome Haplogroup Distribution in Indo-European Speaking Tribes of Gujarat, Western India". PLOS ONE. 9: e90414. doi:10.1371/journal.pone.0090414.
  83. ↑ Fornarino, Simona; et al. (2009). "Mitochondrial and Y-chromosome diversity of the Tharus (Nepal): a reservoir of genetic variation". BMC Evol Biol. 9: 154. doi:10.1186/1471-2148-9-154.
  84. ↑ Nahar Gazi, Nurun; et al. "Genetic Structure of Tibeto-Burman Populations of Bangladesh: Evaluating the Gene Flow along the Sides of Bay-of-Bengal". PLOS ONE. 8: e75064. doi:10.1371/journal.pone.0075064.
  85. ↑ Malyarchuk, B. A.; et al. (2008). "Gene Pool Structure of Russian Populations from the European Part of Russia Inferred from the Data on Y Chromosome Haplogroups Distribution". Russian Journal of Genetics. 44 (2): 187–192. doi:10.1134/S1022795408020105.
  86. ↑ Khar'kov, VN; et al. (Aug 2005). "Frequencies of Y chromosome binary haplogroups in Belarussians". Genetika. 41 (8): 1132–6. PMID 16161635.
  87. ↑ https://www.familytreedna.com/groups/ukraine/dna-results
  88. ↑ http://www.eupedia.com/europe/european_y-dna_haplogroups.shtml
  89. ↑ https://www.familytreedna.com/groups/polish/dna-results
  90. ↑ Ehler, Edvard; et al. (Jun 2011). "Y-chromosomal diversity of the Valachs from the Czech Republic: model for isolated population in Central Europe". Croat Med J. 52 (3): 358–367. doi:10.3325/cmj.2011.52.358.
  91. ↑ https://www.familytreedna.com/groups/slovakia/dna-results
  92. ↑ https://www.familytreedna.com/groups/hungarian-magyar-y-dna-project/dna-results
  93. ↑ Kristiina, Tambets. The Western; Eastern; et al. (Apr 2004). "Outliers" Told by Mitochondrial DNA and Y Chromosomes". Am J Hum Genet. 74 (4): 661–682. doi:10.1086/383203.
  94. ↑ https://www.familytreedna.com/groups/romania/dna-results
  95. ↑ Varzari, Alexander; et al. "Paleo-Balkan and Slavic Contributions to the Genetic Pool of Moldavians: Insights from the Y Chromosome". PLOS ONE. 8: e53731. doi:10.1371/journal.pone.0053731.
  96. ↑ Karachanak, Sena; et al. (2013). "Y-Chromosome Diversity in Modern Bulgarians: New Clues about Their Ancestry". PLOS ONE. 8 (3): e56779. doi:10.1371/journal.pone.0056779.
  97. ↑ Csányi, B.; et al. "Y-Chromosome Analysis of Ancient Hungarian and Two Modern Hungarian-Speaking Populations from the Carpathian Basin". Annals of Human Genetics. 72 (4): 519–534. doi:10.1111/j.1469-1809.2008.00440.x.
  98. ↑ Hungarian Bukovina
  99. 1 2 3 Q-L712 Subclades of haplogroup Q-M25: Q-L712, Q-L715, Q-L713, Q-YP789
  100. ↑ https://www.familytreedna.com/groups/armeniadnaproject/dna-results
  101. ↑ Swedish Haplogroup Database
  102. 1 2 3 David K. Faux, 2007, The Genetic Link of the Viking – Era Norse to Central Asia: An Assessment of the Y Chromosome DNA, Archaeological, Historical and Linguistic Evidence, http://www.davidkfaux.org/CentralAsiaRootsofScandinavia-Y-DNAEvidence.pdf
  103. ↑ https://www.familytreedna.com/groups/norway/dna-results
  104. ↑ Allison Mann, Vikings, merchants, and pirates at the top of the world : Y-chromosomal signatures of recent and ancient migrations in the Faroe Islands, MA Thesis of University of Louisville, 2012.
  105. ↑ Shetland Islands Haplogroups R1a & Q
  106. ↑ https://www.familytreedna.com/groups/finland/dna-results
  107. ↑ https://www.familytreedna.com/public/Latvia/default.aspx?section=yresults
  108. ↑ https://www.familytreedna.com/public/LithuanianDNA/default.aspx?section=yresults
  109. ↑ https://www.familytreedna.com/public/switzerland/default.aspx?section=yresults
  110. 1 2 Kalevi Wiik, Where did European Men Come From?, Journal of Genetic Genealogy 4 (2008):35-85
  111. ↑ Di Gaetano, Cornelia; et al. (Jan 2009). "Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome". Eur J Hum Genet. 17 (1): 91–99. doi:10.1038/ejhg.2008.120.
  112. ↑ Brisighelli, F (2012). "Uniparental markers of contemporary Italian population reveals details on its pre-Roman heritage". PLOS ONE. 7 (12): e50794. doi:10.1371/journal.pone.0050794. In Table S4, #BEL50 is estimated to be Q-M378 by haplotype, though it is shown as just P* (xR1).
  113. 1 2 Behar, DM; et al. (Mar 2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations". Hum Genet. 114 (4): 354–65. doi:10.1007/s00439-003-1073-7. PMID 14740294.
  114. ↑ Susan, M.; et al. (Dec 2008). "Adams et al. The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula". Am J Hum Genet. 83 (6): 725–736. doi:10.1016/j.ajhg.2008.11.007. PMC 2668061Freely accessible. PMID 19061982.
  115. ↑ Alain Farhi et al., Preliminary Results of Sephardic DNA Testing, AVOTAYNU Volume XXIII, Number 2 Summer 2007, p.10
  116. ↑ Grugni, Viola; Battaglia, Vincenza; Hooshiar Kashani, Baharak; Parolo, Silvia; Al-Zahery, Nadia; Achilli, Alessandro; Olivieri, Anna; Gandini, Francesca; Houshmand, Massoud; Sanati, Mohammad Hossein; Torroni, Antonio; Semino, Ornella (2012). "Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians". PLoS ONE. 7 (7): e41252. doi:10.1371/journal.pone.0041252. PMC 3399854Freely accessible. PMID 22815981.
  117. ↑ Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Maksimov, Arkady; Wozniak, Marcin; Grzybowski, Tomasz; Dambueva, Irina; Zakharov, Ilya (2011). "Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a". Journal of Human Genetics. 56 (8): 583–8. doi:10.1038/jhg.2011.64. PMID 21677663.
  118. 1 2 3 4 5 6 7 Di Cristofaro, J; Pennarun, E; Mazières, S; Myres, NM; Lin, AA; et al. (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLoS ONE. 8 (10): e76748. doi:10.1371/journal.pone.0076748.
  119. ↑ Cai, X; Qin, Z; Wen, B; Xu, S; Wang, Y; Lu, Yan; Wei, Lanhai; Wang, Chuanchao; Li, Shilin; Huang, Xingqiu; Jin, Li; Li, Hui (2011). "Human Migration through Bottlenecks from Southeast Asia into East Asia during Last Glacial Maximum Revealed by Y Chromosomes". PLoS ONE. 6 (8): e24282. doi:10.1371/journal.pone.0024282. PMC 3164178Freely accessible. PMID 21904623.
  120. ↑ Zalloua, Pierre A.; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, DE; Royyuru, AK; Herrera, RJ; et al. (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". American Journal of Human Genetics. 82 (4): 873–882. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286Freely accessible. PMID 18374297.
  121. ↑ "Learn about Y-DNA Haplogroup Q". Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Retrieved 2009-11-21.
  122. ↑ Bortolini MC, Salzano FM, Thomas MG, et al. (September 2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas" (PDF). Am. J. Hum. Genet. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678Freely accessible. PMID 12900798.
  123. ↑ Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon; et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation. 24 (3): 248–60. doi:10.1002/humu.20077. PMID 15300852. Q-M323 in 3/20=15% of a sample of Yemenite Jews.
  124. ↑ Zhong, H.; Shi, H.; Qi, X.-B.; Duan, Z.-Y.; Tan, P.-P.; Jin, L.; Su, B.; Ma, R. Z. (2010). "Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route". Molecular Biology and Evolution. 28 (1): 717–27. doi:10.1093/molbev/msq247. PMID 20837606.
  125. ↑ Adams, S. M.; Bosch, E.; Balaresque, P. L.; Ballereau, S. J.; Lee, A. C.; Arroyo, E.; López-Parra, A. M.; Aler, M.; et al. (2008). "The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula". Am J Hum Genet. 83 (6): 725–736. doi:10.1016/j.ajhg.2008.11.007. PMC 2668061Freely accessible. PMID 19061982.
  126. ↑ The First Peopling of South America: New Evidence from Y-Chromosome Haplogroup Q Vincenza Battaglia, Viola Grugni, Ugo Alessandro Perego, Norman Angerhofer, J. Edgar Gomez-Palmieri, Scott Ray Woodward, Alessandro Achilli, Natalie Myres, Antonio Torroni, Ornella Semino
  127. ↑ YFull - Experimental Y Tree, Y-SNP calls for Afontova Gora 2, Afantova had haplogroup Q1a1 and some type of R derived mtdna.
  128. ↑ Rasmussen, M.; Anzick, S.; et al. (February 2014). "The genome of a Late Pleistocene human from a Clovis burial site in western Montana". Nature. 506: 225–229. doi:10.1038/nature13025. PMID 24522598.
  129. ↑ Jennifer A. Raff & Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162–163.
  130. ↑ The ancestry and affiliations of Kennewick Man
  131. ↑ Hollard et al., Strong genetic admixture in the Altai at the Middle Bronze Age revealed by uniparental and ancestry informative makers, Forensic Science International: Genetics, published online 4 June 2014
  132. ↑ Rasmussen, M.; et al. "Ancient human gonome sequence of an extinct Palaeo-Eskimo". Nature. 463: 757–762. doi:10.1038/nature08835. PMC 3951495Freely accessible. PMID 20148029.
  133. 1 2 On Henbei, Pengyang, and Heigouliang, Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
  134. ↑ Yong-Bin Zhao et al., Ancient DNA evidence reveals that the Y chromosome haplogroup Q1a1 admixture into the Han Chinese 3,000 years ago, American Journal of Human Biology (Aug 2014).
  135. ↑ Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
  136. ↑ L. L. Kang et al., Y chromosomes of ancient Hunnu people and its implication on the phylogeny of East Asian linguistic families (2013)
  137. ↑ Knowing the Xiongnu Culture in Eastern Tianshan Mountain from Tomb Heigouliang and Dongheigou Site at the Beginning of Xihan Dynasty, RenMeng, WangJianXin, 2008
  138. ↑ Qui, Y; et al. (2015). "Identification of kinship and occupant status in Mongolian noble burials of the Yuan dynasty through a multidisciplinary approach". Phil. Trans. R. Soc. B370: 20130378. doi:10.1098/rstb.2013.0378.

Bibliography

External links

This article is issued from Wikipedia - version of the 10/28/2016. The text is available under the Creative Commons Attribution/Share Alike but additional terms may apply for the media files.